Data for the Transcription Mapping: yycG

RNA used
Probe:ss RNA
Probe preparation:
Region used for hybridization is the same as the cloned region: no
Primer:
Forward Primer yycG-FGCGAGAACGAGAAAGCTTGG
Reverse Primer yycG-T7RtaatacgactcactatagggcgaGCTTCATCCCAATCATCCTC

Labeling Method:DIG

Northern Image: yes
Figure of the Trascription Map: yes

Comment:

Correspondence: