Data for the Constructed Mutant: YQJDd

General Information

Name of the MutantYQJDd (disruption)
Used VectorpMutinT3
Used Enzyme SitesHindIII and BamHI
Gene Size1518 (nt)

Growth & Expression (reporter lacZ):
in DSM:yes
in MM:no

Mutant Submission to NIG:no

Mutant Construction for YQJDd (disruption)

[Construction of the Mutant]

Primers used for Cloning:
Forward Primer:(aagaagctt tag) yqjD-F: aagaagcttACATGGATCATTTTTACAC
Reverse Primer:(taatacgactcactatagggcgaggatcc tag) yqjD-R: taatacgactcactatagggcgaggatccACTTTCCATGAAGGGGTG
Length of the Cloned Region: 7 to 168 Length: 162
+1 is the first nucleotide of the putative initiation codon

[Confirmation of the Constructed Mutant]

1st Level Phenotype Analysis of YQJDd