Data for the Constructed Mutant: YQIZd

General Information

Name of the MutantYQIZd (disruption)
Host
Used VectorpMutinT3
Used Enzyme SitesHindIII and BamHI
Gene Size720 (nt)

Growth & Expression (reporter lacZ):
in DSM:yes
in MM:no

Mutant Submission to NIG:yes
Correspondence:


Mutant Construction for YQIZd (disruption)

[Construction of the Mutant]

Primers used for Cloning:
Forward Primer:(aagaagctt tag) : aagaagcttATTAAGGTTGAAAAGCTGTC
Reverse Primer:(taatacgactcactatagggcgaggatcc tag) : taatacgactcactatagggcgaggatccAAAGAGATGAAAATGCTG
Length of the Cloned Region: 4 to 267 Length: 264
+1 is the first nucleotide of the putative initiation codon

[Confirmation of the Constructed Mutant]


1st Level Phenotype Analysis of YQIZd