Data for the Constructed Mutant: YQIEp

General Information

Name of the MutantYQIEp (promoter fusion)
Host
Used VectorpMutinT3
Used Enzyme SitesHindIII and BamHI
Gene Size1899 (nt)

Growth & Expression (reporter lacZ):
in DSM:no
in MM:no

Mutant Submission to NIG:no
Correspondence:


Mutant Construction for YQIEp (promoter fusion)

[Construction of the Mutant]

Primers used for Cloning:
Forward Primer:(aagaagctt tag) yqiE-F2: aagaagcttGTATCATTGCAGAAATTCATGCTG
Reverse Primer:(taatacgactcactatagggcgaggatcc tag) yqiE-T7R: taatacgactcactatagggcgaggatccACTCCGCTTTGGAAATCC
Length of the Cloned Region: -41 to 309 Length: 351
+1 is the first nucleotide of the putative initiation codon

[Confirmation of the Constructed Mutant]


1st Level Phenotype Analysis of YQIEp