Data for the Constructed Mutant: YQIBp

General Information

Name of the MutantYQIBp (promoter fusion)
Host
Used VectorpMutinT3
Used Enzyme SitesHindIII and BamHI
Gene Size1344 (nt)

Growth & Expression (reporter lacZ):
in DSM:no
in MM:no

Mutant Submission to NIG:no
Correspondence:


Mutant Construction for YQIBp (promoter fusion)

[Construction of the Mutant]

Primers used for Cloning:
Forward Primer:(aagaagctt tag) yqiB-F2: aagaagcttGCAGGAATGCTTAGGAGAGG
Reverse Primer:(taatacgactcactatagggcgaggatcc tag) yqiB-T7R: taatacgactcactatagggcgaggatccATAGTTTCCGCTCGGTTC
Length of the Cloned Region: -30 to 282 Length: 313
+1 is the first nucleotide of the putative initiation codon

[Confirmation of the Constructed Mutant]


1st Level Phenotype Analysis of YQIBp