Data for the Constructed Mutant: RIPXd

General Information

Name of the MutantRIPXd (disruption)
Host
Used VectorpMutinT3
Used Enzyme SitesHindIII and BamHI
Gene Size888 (nt)

Growth & Expression (reporter lacZ):
in DSM:yes
in MM:no

Mutant Submission to NIG:yes
Correspondence:


Mutant Construction for RIPXd (disruption)

[Construction of the Mutant]

Primers used for Cloning:
Forward Primer:(aagaagctt tag) ripX-F: aagaagcttGATCAAATAAAGGATTTCATC
Reverse Primer:(taatacgactcactatagggcgaggatcc tag) ripX-R: taatacgactcactatagggcgaggatccCCTGAGCAGAAATTGATG
Length of the Cloned Region: 7 to 261 Length: 255
+1 is the first nucleotide of the putative initiation codon

[Confirmation of the Constructed Mutant]


1st Level Phenotype Analysis of RIPXd