Data for the Constructed Mutant: YQIHd

General Information

Name of the MutantYQIHd (disruption)
Host
Used VectorpMutinT3
Used Enzyme SitesHindIII and BamHI
Gene Size291 (nt)

Growth & Expression (reporter lacZ):
in DSM:yes
in MM:no

Mutant Submission to NIG:no
Correspondence:


Mutant Construction for YQIHd (disruption)

[Construction of the Mutant]

Primers used for Cloning:
Forward Primer:(aagaagctt tag) yqiH-F: aagaagcttAAACAAACGGTTCTTTTGC
Reverse Primer:(taatacgactcactatagggcgaggatcc tag) yqiH-T7R: taatacgactcactatagggcgaggatccATGAGGATCAGCCGAGCC
Length of the Cloned Region: 4 to 126 Length: 123
+1 is the first nucleotide of the putative initiation codon

[Confirmation of the Constructed Mutant]


1st Level Phenotype Analysis of YQIHd