Data for the Constructed Mutant: PABCd

General Information

Name of the MutantPABCd (disruption)
Host168
Used VectorpMutinT3
Used Enzyme SitesHindIII and BamHI
Gene Size879 (nt)

Growth & Expression (reporter lacZ):
in DSM:no
in MM:no

Mutant Submission to NIG:
Correspondence:


Mutant Construction for PABCd (disruption)

[Construction of the Mutant]

Primers used for Cloning:
Forward Primer:(aagaagct tag) pabC-F: aagaagctTGTGAACGGCCGGTATAT
Reverse Primer:(taatacgactcactatagggcgagga tag) pabC-R: taatacgactcactatagggcgaggaTCCAGCATCTCAAGGATC
Length of the Cloned Region: 9 to 218 Length: 210
+1 is the first nucleotide of the putative initiation codon

[Confirmation of the Constructed Mutant]


1st Level Phenotype Analysis of PABCd