Data for the Constructed Mutant: PABBd

General Information

Name of the MutantPABBd (disruption)
Host168
Used VectorpMutinT3
Used Enzyme SitesHindIII and BamHI
Gene Size1410 (nt)

Growth & Expression (reporter lacZ):
in DSM:no
in MM:no

Mutant Submission to NIG:
Correspondence:


Mutant Construction for PABBd (disruption)

[Construction of the Mutant]

Primers used for Cloning:
Forward Primer:(aagaag tag) pabB-F: aagaagCTTTTCAAAAAGACTCAT
Reverse Primer:(taatacgactcactatagggcgaggat tag) pabB-R: taatacgactcactatagggcgaggatCCAGCTGTGGAAGGCCCG
Length of the Cloned Region: 35 to 249 Length: 215
+1 is the first nucleotide of the putative initiation codon

[Confirmation of the Constructed Mutant]


1st Level Phenotype Analysis of PABBd