Data for the Constructed Mutant: YABJdd

General Information

Name of the MutantYABJdd (deletion (double-cross))
Host168
Used VectorpMutinT3
Used Enzyme SitesHindIII-XhoI & XhoI-BamHI
Gene Size375 (nt)

Growth & Expression (reporter lacZ):
in DSM:yes
in MM:yes

Mutant Submission to NIG:yes
Correspondence:


Mutant Construction for YABJdd (deletion (double-cross))

[Construction of the Mutant]

Primers used for Deletion:
Upstream:
Forward Primer:(aaacgcctc tag) yabJ-UF:aaacgcctcGAGCGCGAAATTGATGTTGTC
Reverse Primer:(agaaatggat tag) yabJ-UR:agaaatggatCCGCTGGGGCATGTTTTGTG
Downstream:
Forward Primer:( tag) yabJ-DF:GAAATGAAAGCTTTATGACC
Reverse Primer:(aaacgcctcg tag) yabJ-DR: aaacgcctcgAGAATTAAAAAAGGACCGCC
Linearization:
Length of the Deletion: -374 to -413 Length: 40


[Confirmation of the Constructed Mutant]


1st Level Phenotype Analysis of YABJdd