Data for the Constructed Mutant: RECRd

General Information

Name of the MutantRECRd (disruption)
Host168
Used VectorpMutinT3
Used Enzyme SitesHindIII and BamHI
Gene Size594 (nt)

Growth & Expression (reporter lacZ):
in DSM:no
in MM:no

Mutant Submission to NIG:
Correspondence:


Mutant Construction for RECRd (disruption)

[Construction of the Mutant]

Primers used for Cloning:
Forward Primer:(aagaagct tag) recR-F: aagaagctTCCTGAACCAATATCAAA
Reverse Primer:(taatacgactcactatagggcgagg tag) recR-R: taatacgactcactatagggcgaggATCCCTGCGCGTATCTTC
Length of the Cloned Region: 9 to 234 Length: 226
+1 is the first nucleotide of the putative initiation codon

[Confirmation of the Constructed Mutant]


1st Level Phenotype Analysis of RECRd