Data for the Constructed Mutant: YYATd

General Information

Name of the MutantYYATd (disruption)
Host
Used VectorpMutinT3
Used Enzyme SitesHindIII and BamHI
Gene Size444 (nt)

Growth & Expression (reporter lacZ):
in DSM:yes
in MM:no

Mutant Submission to NIG:no
Correspondence:


Mutant Construction for YYATd (disruption)

[Construction of the Mutant]

Primers used for Cloning:
Forward Primer:( tag) yyaT-F: CATGAAGCTTTAAAGATTAG
Reverse Primer:(ggaggatcc tag) yyaT-R: ggaggatccCCCCAATCCGTACTTACG
Length of the Cloned Region: -444 to -444 Length: 1
+1 is the first nucleotide of the putative initiation codon

[Confirmation of the Constructed Mutant]


1st Level Phenotype Analysis of YYATd