BSTF Data for BG11986


ORF IDBG11986
SynonymxylR
ClassHTH
Familyunique
Family description
Mutant/Isogenic strainWH340/WH335(2)
Sensor
Target genesxylAB(1)
cis SequenceTTAGTTTGTTGGGCAACAAACTAA(3)
Ligandxylose(inducer both in medium and cell) (3)
CommentGlucose and glucose-6-phosphate interaction with XylR (4).
Reference
1. Kreuzer P, Gartner D, Allmansberger R, Hillen W (1989) Identification and sequence analysis of the Bacillus subtilis W23 xylR gene and xyl operator. J Bacteriol 171:3840-5.[PMID:2544559]
2. Kraus A, Hueck C, Gartner D, Hillen W (1994) Catabolite repression of the Bacillus subtilis xyl operon involves a cis element functional in the context of an unrelated sequence, and glucose exerts additional xylR-dependent repression. J Bacteriol 176:1738-45.[PMID:8132469]
3. Gartner D, Degenkolb J, Ripperger JA, Allmansberger R, Hillen W (1992) Regulation of the Bacillus subtilis W23 xylose utilization operon: interaction of the Xyl repressor with the xyl operator and the inducer xylose. Mol Gen Genet 232:415-22.[PMID:1588910]
4. Dahl MK, Schmiedel D, Hillen W (1995) Glucose and glucose-6-phosphate interaction with Xyl repressor proteins from Bacillus spp. may contribute to regulation of xylose utilization. J Bacteriol 177:5467-72.[PMID:7559331]
PubMed search
Ortholog SSDB     COG
Paralog SSDB
Motif SSDB
Localization PSORT   SOSUI