BSTF Data for BG10982


ORF IDBG10982
SynonymdeoR,yxxC
ClassHTH
Familyunique
Family description
Mutant/Isogenic strainHH232/168(1)
Sensor
Target genesdra-nupC-pdp(1,2,3)
cis SequenceATTGAACAAAATTTCAATTACCAATTTACATATGTTCAA(2)
Liganddeoxyribonucleoside, deoxyribose(inducer in medium) (1), dRib-5-P, dRib-1-P(inducer in cell) (2)
Comment
Reference
1. Saxild HH, Andersen LN, Hammer K (1996) Dra-nupC-pdp operon of Bacillus subtilis: nucleotide sequence, induction by deoxyribonucleosides, and transcriptional regulation by the deoR-encoded DeoR repressor protein. J Bacteriol 178:424-34. [PMID:8550462]
2. Zeng X, Saxild HH (1999) Identification and characterization of a DeoR-specific operator sequence essential for induction of dra-nupC-pdp operon expression in Bacillus subtilis. J Bacteriol 181:1719-27. [PMID:10074062]
3. Zeng X, Saxild HH, Switzer RL (2000) Purification and characterization of the DeoR repressor of Bacillus subtilis. J Bacteriol 182:1916-22. [PMID:10714997]
PubMed search
Ortholog SSDB     COG
Paralog SSDB
Motif SSDB
Localization PSORT   SOSUI